| align-utils {Biostrings} | R Documentation |
A variety of different functions used to deal with sequence alignments.
nedit(x) # also nmatch and nmismatch
mismatchTable(x, shiftLeft=0L, shiftRight=0L, ...)
mismatchSummary(x, ...)
## S4 method for signature 'AlignedXStringSet0':
coverage(x, shift=0L, width=NULL, weight=1L)
## S4 method for signature 'PairwiseAlignedFixedSubject':
coverage(x, shift=0L, width=NULL, weight=1L)
compareStrings(pattern, subject)
## S4 method for signature 'PairwiseAlignedFixedSubject':
consensusMatrix(x,
as.prob=FALSE, freq=FALSE, shift=0L, width=NULL,
baseOnly=FALSE, gapCode="-", endgapCode="-")
x |
A character vector or matrix, XStringSet, XStringViews,
PairwiseAlignedXStringSet, or list of FASTA records containing
the equal-length strings.
|
shiftLeft, shiftRight |
Non-positive and non-negative integers respectively that specify how many preceding and succeeding characters to and from the mismatch position to include in the mismatch substrings. |
... |
Further arguments to be passed to or from other methods. |
shift, width |
See ?coverage.
|
weight |
An integer vector specifying how much each element in x counts.
|
pattern, subject |
The strings to compare. Can be of type character, XString,
XStringSet, AlignedXStringSet, or, in the case of
pattern, PairwiseAlignedXStringSet. If pattern is a
PairwiseAlignedXStringSet object, then subject must be
missing.
|
as.prob |
If TRUE then probabilities are reported,
otherwise counts (the default).
|
freq |
This argument is deprecated.
Please use the as.prob argument instead.
|
baseOnly |
TRUE or FALSE.
If TRUE, the returned vector only contains frequencies for the
letters in the "base" alphabet i.e. "A", "C", "G", "T" if x
is a "DNA input", and "A", "C", "G", "U" if x is "RNA input".
When x is a BString object (or an XStringViews
object with a BString subject, or a BStringSet object),
then the baseOnly argument is ignored.
|
gapCode, endgapCode |
The codes in the appropriate alphabet to use for the internal
and end gaps.
|
mismatchTable: a data.frame containing the positions and substrings
of the mismatches for the AlignedXStringSet or
PairwiseAlignedXStringSet object.
mismatchSummary: a list of data.frame objects containing counts and
frequencies of the mismatches for the AlignedXStringSet or
PairwiseAlignedFixedSubject object.
compareStrings combines two equal-length strings that are assumed to be
aligned into a single character string containing that replaces mismatches
with "?", insertions with "+", and deletions with "-".
pairwiseAlignment,
consensusMatrix,
XString-class, XStringSet-class, XStringViews-class,
AlignedXStringSet-class, PairwiseAlignedXStringSet-class,
match-utils
## Compare two globally aligned strings
string1 <- "ACTTCACCAGCTCCCTGGCGGTAAGTTGATC---AAAGG---AAACGCAAAGTTTTCAAG"
string2 <- "GTTTCACTACTTCCTTTCGGGTAAGTAAATATATAAATATATAAAAATATAATTTTCATC"
compareStrings(string1, string2)
## Create a consensus matrix
nw1 <-
pairwiseAlignment(AAStringSet(c("HLDNLKGTF", "HVDDMPNAL")), AAString("SMDDTEKMSMKL"),
substitutionMatrix = "BLOSUM50", gapOpening = -3, gapExtension = -1)
consensusMatrix(nw1)
## Examine the consensus between the bacteriophage phi X174 genomes
data(phiX174Phage)
phageConsmat <- consensusMatrix(phiX174Phage, baseOnly = TRUE)
phageDiffs <- which(apply(phageConsmat, 2, max) < length(phiX174Phage))
phageDiffs
phageConsmat[,phageDiffs]